|
Thermo Fisher
pmd2 g envelope vector dna Pmd2 G Envelope Vector Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g envelope vector dna/product/Thermo Fisher Average 99 stars, based on 1 article reviews
pmd2 g envelope vector dna - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Addgene inc
g0345 pspax2 addgene ![]() G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g0345 pspax2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vector dna ![]() Pmd2 G Vector Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g vector dna/product/Addgene inc Average 93 stars, based on 1 article reviews
pmd2 g vector dna - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp btn3a1 hs01063368 m1 ![]() Gene Exp Btn3a1 Hs01063368 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp btn3a1 hs01063368 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp btn3a1 hs01063368 m1 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
plasmid dna ![]() Plasmid Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid dna/product/Thermo Fisher Average 90 stars, based on 1 article reviews
plasmid dna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Millipore
plko.1-puro vectors ![]() Plko.1 Puro Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1-puro vectors/product/Millipore Average 90 stars, based on 1 article reviews
plko.1-puro vectors - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vectors ![]() Pmd2 G Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g vectors/product/Addgene inc Average 96 stars, based on 1 article reviews
pmd2 g vectors - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g ![]() Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g/product/Addgene inc Average 97 stars, based on 1 article reviews
pmd2 g - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vsvg ![]() Pmd2 G Vsvg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g vsvg/product/Addgene inc Average 98 stars, based on 1 article reviews
pmd2 g vsvg - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g envelope vector ![]() Pmd2 G Envelope Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g envelope vector/product/Addgene inc Average 96 stars, based on 1 article reviews
pmd2 g envelope vector - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma
doi: 10.1016/j.cell.2020.03.062
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat#
Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software
Journal: Molecular Therapy. Nucleic Acids
Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing
doi: 10.1016/j.omtn.2023.02.009
Figure Lengend Snippet: Analysis of LNS-associated HPRT1 variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg
Techniques: Mutagenesis, Derivative Assay, CRISPR
Journal: Molecular Therapy. Nucleic Acids
Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing
doi: 10.1016/j.omtn.2023.02.009
Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutations using CBEs and ABEs (A) Schematic overview of BE-meditated disease modeling and gene correction in human cells. (B) Target sequences of CBEs and ABEs for LNS-associated HPRT1 variants, c.430C>T (p.Q144∗) and c.508C>T (p.R170∗). The spacer sequences are indicated by boxes, and the target C:G pairs of CBEs and A:T pairs of ABEs are shown in blue and red, respectively. PAM sequences of each target site are shown in bold. (C) Heatmaps of CBE-mediated base editing frequencies for disease modeling of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as means from two biologically independent samples. (D) Heatmaps of ABE-meditated base editing frequencies for correction of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as the mean of three biologically independent samples. (E) Sanger sequencing results of endogenous c.430C>T (p.Q144∗) and c.508C>T (p.R170∗) target sites in mutated and corrected HAP1 cells. The red boxes indicate nucleotides converted by CBEs and ABEs. (F) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (G) Crystal violet staining of mutated and corrected HAP1 cells selected in media containing 6-TG or HAT. (H) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells.
Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg
Techniques: Derivative Assay, Sequencing, Western Blot, Expressing, Staining, Activity Assay
Journal: Molecular Therapy. Nucleic Acids
Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing
doi: 10.1016/j.omtn.2023.02.009
Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutation using PE (A) Schematic overview of PE-mediated disease modeling and gene correction in human cells. The patient-derived HPRT1 mutation, c.333_334ins(A), is representatively described. (B) Target sequences of PEs for the LNS-associated HPRT1 mutation, c.333_334ins(A) (p.G112Rfs∗10). The representative spacer-#1 sequence and PAM sequence are indicated in box and bold, respectively. The inserted adenine is highlighted in red. (C) Prime editing frequencies for introducing c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (D) Prime editing frequencies of PE2, PE3, and PE3b to induce c.333_334ins(A) mutation. (E) Prime editing frequencies for correcting c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (F) Prime editing frequencies with PE2 and PE3b to correct c.333_334ins(A) mutation. (G) Sanger sequencing results of endogenous c.333_334ins(A) (p.G112Rfs∗10) target sites in mutated and corrected HAP1 cells. The red arrow indicates the adenine inserted for disease modeling and gene correction by PEs. (H) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (I) Crystal violet staining of PE-mediated mutated and corrected HAP1 cells selected with media containing 6-TG or HAT. (J) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells. Data are means from two or three biologically independent samples, and error bars indicate the standard error of the mean.
Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg
Techniques: Derivative Assay, Mutagenesis, Sequencing, Western Blot, Expressing, Staining, Activity Assay
Journal: Molecular Therapy. Nucleic Acids
Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing
doi: 10.1016/j.omtn.2023.02.009
Figure Lengend Snippet: PE-mediated gene correction of c.333_334ins(A) mutations in patient-derived fibroblasts (A) Renal ultrasound results of a patient with LNS with HPRT1 c.333_334ins(A) mutation. (B) Family pedigree of the patient with LNS with HPRT1 c.333_334ins(A) mutation. Fibroblasts were obtained from the patient with LNS as indicated with the red arrow. (C) Sequencing analysis of patient-derived fibroblasts to confirm the HPRT1 c.333_334ins(A) mutation. (D) Prime editing frequencies of various types of improved PEs and pegRNAs (top) for correcting the HPRT1 c.333_334ins(A) mutation. The red arrow indicates the pegRNA used in the subsequent experiment. Representative results of high-throughput sequencing of patient-derived fibroblasts treated with PE5max and tevopreQ pegRNA to correct the HPRT1 c.333_334ins(A) mutation (bottom) are shown. (E) Crystal violet staining of PE-mediated corrected fibroblasts with media containing 6-TG or HAT. Data are means from two biologically independent samples, and error bars indicate the standard error of the mean. (F) Western blotting analysis of HPRT protein expression in patient-derived fibroblast cells and HPRT1 c.333_334ins(A)-corrected patient-derived fibroblasts selected with HAT medium. GAPDH was used as an internal control.
Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg
Techniques: Derivative Assay, Mutagenesis, Sequencing, Next-Generation Sequencing, Staining, Western Blot, Expressing