pmd2 g envelope vector dna Search Results


99
Thermo Fisher pmd2 g envelope vector dna
Pmd2 G Envelope Vector Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g envelope vector dna/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
pmd2 g envelope vector dna - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

98
Addgene inc g0345 pspax2 addgene
KEY RESOURCES TABLE
G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/g0345 pspax2 addgene/product/Addgene inc
Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

93
Addgene inc pmd2 g vector dna
KEY RESOURCES TABLE
Pmd2 G Vector Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g vector dna/product/Addgene inc
Average 93 stars, based on 1 article reviews
pmd2 g vector dna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp btn3a1 hs01063368 m1
KEY RESOURCES TABLE
Gene Exp Btn3a1 Hs01063368 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp btn3a1 hs01063368 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp btn3a1 hs01063368 m1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Thermo Fisher plasmid dna
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Plasmid Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid dna/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
plasmid dna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Millipore plko.1-puro vectors
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Plko.1 Puro Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1-puro vectors/product/Millipore
Average 90 stars, based on 1 article reviews
plko.1-puro vectors - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Addgene inc pmd2 g vectors
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Pmd2 G Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g vectors/product/Addgene inc
Average 96 stars, based on 1 article reviews
pmd2 g vectors - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

97
Addgene inc pmd2 g
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g/product/Addgene inc
Average 97 stars, based on 1 article reviews
pmd2 g - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

98
Addgene inc pmd2 g vsvg
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Pmd2 G Vsvg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g vsvg/product/Addgene inc
Average 98 stars, based on 1 article reviews
pmd2 g vsvg - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

96
Addgene inc pmd2 g envelope vector
Analysis of <t>LNS-associated</t> <t>HPRT1</t> variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.
Pmd2 G Envelope Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g envelope vector/product/Addgene inc
Average 96 stars, based on 1 article reviews
pmd2 g envelope vector - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma

doi: 10.1016/j.cell.2020.03.062

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat# G0345 psPAX2 Addgene Cat# 12259 pCMV-VSV-G Addgene Cat# 8454 Software and Algorithms ImageJ NIH N/A QuPath v0.1.2 Github N/A Prism v8.0 Graphpad N/A Image Studio Lite LI-COR N/A PHATE https://github.com/KrishnaswamyLab/PHATE N/A MAGIC https://github.com/KrishnaswamyLab/MAGIC N/A FASTX-toolkit Greg Hannon lab ( http://hannonlab.cshl.edu/fastx_toolkit ) N/A Burrows-Wheeler Aligner v0.5.5 Source Forge N/A Picard toolkit v1.21 Github N/A GATK v.1.0.5538 Broad Institute N/A ANNOVAR http://annovar.openbioinformatics.org/ N/A RSEM v.1.2.12 Dewey lab/Github N/A Cytoscape v.3.3.0 Cytoscape Consortium N/A Cell Ranger 10X Genomics N/A SAS v9.4 SAS Institute, Inc. N/A MELD https://github.com/KrishnaswamyLab/MELD N/A diffxpy https://github.com/theislab/diffxpy/ N/A R package JADE https://www.rdocumentation.org/packages/JADE/versions/1.1-0 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software

Analysis of LNS-associated HPRT1 variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Analysis of LNS-associated HPRT1 variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Mutagenesis, Derivative Assay, CRISPR

Introduction and correction of patient-derived HPRT1 mutations using CBEs and ABEs (A) Schematic overview of BE-meditated disease modeling and gene correction in human cells. (B) Target sequences of CBEs and ABEs for LNS-associated HPRT1 variants, c.430C>T (p.Q144∗) and c.508C>T (p.R170∗). The spacer sequences are indicated by boxes, and the target C:G pairs of CBEs and A:T pairs of ABEs are shown in blue and red, respectively. PAM sequences of each target site are shown in bold. (C) Heatmaps of CBE-mediated base editing frequencies for disease modeling of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as means from two biologically independent samples. (D) Heatmaps of ABE-meditated base editing frequencies for correction of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as the mean of three biologically independent samples. (E) Sanger sequencing results of endogenous c.430C>T (p.Q144∗) and c.508C>T (p.R170∗) target sites in mutated and corrected HAP1 cells. The red boxes indicate nucleotides converted by CBEs and ABEs. (F) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (G) Crystal violet staining of mutated and corrected HAP1 cells selected in media containing 6-TG or HAT. (H) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells.

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutations using CBEs and ABEs (A) Schematic overview of BE-meditated disease modeling and gene correction in human cells. (B) Target sequences of CBEs and ABEs for LNS-associated HPRT1 variants, c.430C>T (p.Q144∗) and c.508C>T (p.R170∗). The spacer sequences are indicated by boxes, and the target C:G pairs of CBEs and A:T pairs of ABEs are shown in blue and red, respectively. PAM sequences of each target site are shown in bold. (C) Heatmaps of CBE-mediated base editing frequencies for disease modeling of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as means from two biologically independent samples. (D) Heatmaps of ABE-meditated base editing frequencies for correction of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as the mean of three biologically independent samples. (E) Sanger sequencing results of endogenous c.430C>T (p.Q144∗) and c.508C>T (p.R170∗) target sites in mutated and corrected HAP1 cells. The red boxes indicate nucleotides converted by CBEs and ABEs. (F) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (G) Crystal violet staining of mutated and corrected HAP1 cells selected in media containing 6-TG or HAT. (H) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Sequencing, Western Blot, Expressing, Staining, Activity Assay

Introduction and correction of patient-derived HPRT1 mutation using PE (A) Schematic overview of PE-mediated disease modeling and gene correction in human cells. The patient-derived HPRT1 mutation, c.333_334ins(A), is representatively described. (B) Target sequences of PEs for the LNS-associated HPRT1 mutation, c.333_334ins(A) (p.G112Rfs∗10). The representative spacer-#1 sequence and PAM sequence are indicated in box and bold, respectively. The inserted adenine is highlighted in red. (C) Prime editing frequencies for introducing c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (D) Prime editing frequencies of PE2, PE3, and PE3b to induce c.333_334ins(A) mutation. (E) Prime editing frequencies for correcting c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (F) Prime editing frequencies with PE2 and PE3b to correct c.333_334ins(A) mutation. (G) Sanger sequencing results of endogenous c.333_334ins(A) (p.G112Rfs∗10) target sites in mutated and corrected HAP1 cells. The red arrow indicates the adenine inserted for disease modeling and gene correction by PEs. (H) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (I) Crystal violet staining of PE-mediated mutated and corrected HAP1 cells selected with media containing 6-TG or HAT. (J) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells. Data are means from two or three biologically independent samples, and error bars indicate the standard error of the mean.

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutation using PE (A) Schematic overview of PE-mediated disease modeling and gene correction in human cells. The patient-derived HPRT1 mutation, c.333_334ins(A), is representatively described. (B) Target sequences of PEs for the LNS-associated HPRT1 mutation, c.333_334ins(A) (p.G112Rfs∗10). The representative spacer-#1 sequence and PAM sequence are indicated in box and bold, respectively. The inserted adenine is highlighted in red. (C) Prime editing frequencies for introducing c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (D) Prime editing frequencies of PE2, PE3, and PE3b to induce c.333_334ins(A) mutation. (E) Prime editing frequencies for correcting c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (F) Prime editing frequencies with PE2 and PE3b to correct c.333_334ins(A) mutation. (G) Sanger sequencing results of endogenous c.333_334ins(A) (p.G112Rfs∗10) target sites in mutated and corrected HAP1 cells. The red arrow indicates the adenine inserted for disease modeling and gene correction by PEs. (H) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (I) Crystal violet staining of PE-mediated mutated and corrected HAP1 cells selected with media containing 6-TG or HAT. (J) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells. Data are means from two or three biologically independent samples, and error bars indicate the standard error of the mean.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Mutagenesis, Sequencing, Western Blot, Expressing, Staining, Activity Assay

PE-mediated gene correction of c.333_334ins(A) mutations in patient-derived fibroblasts (A) Renal ultrasound results of a patient with LNS with HPRT1 c.333_334ins(A) mutation. (B) Family pedigree of the patient with LNS with HPRT1 c.333_334ins(A) mutation. Fibroblasts were obtained from the patient with LNS as indicated with the red arrow. (C) Sequencing analysis of patient-derived fibroblasts to confirm the HPRT1 c.333_334ins(A) mutation. (D) Prime editing frequencies of various types of improved PEs and pegRNAs (top) for correcting the HPRT1 c.333_334ins(A) mutation. The red arrow indicates the pegRNA used in the subsequent experiment. Representative results of high-throughput sequencing of patient-derived fibroblasts treated with PE5max and tevopreQ pegRNA to correct the HPRT1 c.333_334ins(A) mutation (bottom) are shown. (E) Crystal violet staining of PE-mediated corrected fibroblasts with media containing 6-TG or HAT. Data are means from two biologically independent samples, and error bars indicate the standard error of the mean. (F) Western blotting analysis of HPRT protein expression in patient-derived fibroblast cells and HPRT1 c.333_334ins(A)-corrected patient-derived fibroblasts selected with HAT medium. GAPDH was used as an internal control.

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: PE-mediated gene correction of c.333_334ins(A) mutations in patient-derived fibroblasts (A) Renal ultrasound results of a patient with LNS with HPRT1 c.333_334ins(A) mutation. (B) Family pedigree of the patient with LNS with HPRT1 c.333_334ins(A) mutation. Fibroblasts were obtained from the patient with LNS as indicated with the red arrow. (C) Sequencing analysis of patient-derived fibroblasts to confirm the HPRT1 c.333_334ins(A) mutation. (D) Prime editing frequencies of various types of improved PEs and pegRNAs (top) for correcting the HPRT1 c.333_334ins(A) mutation. The red arrow indicates the pegRNA used in the subsequent experiment. Representative results of high-throughput sequencing of patient-derived fibroblasts treated with PE5max and tevopreQ pegRNA to correct the HPRT1 c.333_334ins(A) mutation (bottom) are shown. (E) Crystal violet staining of PE-mediated corrected fibroblasts with media containing 6-TG or HAT. Data are means from two biologically independent samples, and error bars indicate the standard error of the mean. (F) Western blotting analysis of HPRT protein expression in patient-derived fibroblast cells and HPRT1 c.333_334ins(A)-corrected patient-derived fibroblasts selected with HAT medium. GAPDH was used as an internal control.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Mutagenesis, Sequencing, Next-Generation Sequencing, Staining, Western Blot, Expressing